اي استفسار لاي برنامج من برامج تطبيقات حاسوبيه للحيوي :)

[برأءة طفلة]

ترانيم الكفاح
كيفك ياعسل؟
حابة اسئلك في برنامج الراسمول كيف احفظ الملف مدري الصورة
وفي كمان بيانات طالبتها ما عرفت احلها من الموقع <<اذا رديتي بقولك الاسئلة

[ترانيم الكفاح]

شوفي حبيبتي
تروحي لايقونة export
وتختاري gif
واحفظيه في المكان الي تبغيه
واذا ما انفتح معاك ولم يحفظ اعمليله من لوجة المفاتيح : اختاري برينت اسكريب واحفضيه كصوره في الووورد
وبالتوفيق

[.,.نيــــــــــــــــــــران.,.]

المفروض من اول يتثبت الموضوع ^^

جزاك الله خير على ماقدمتي :)

[ترانيم الكفاح]

مشكوووره اخت نيران عالتثبيت واتمنى الاستفاده للجميع

[.vib]

انا جايتكم وانا مكسوفه من الشي الا ح اطلبه

بس غصبا عني انا كنت غايبه في هذي المحاضره ومني فاهمه منها ولا شي

بنزل الواجب وشوفوا ادا قدرتوا تفهموني


Identifying Disease Genes Worksheet

In this activity, you will be given a nucleotide sequence found in real human DNA that is associated with a genetic disease when mutated. Your task is to compare the sequence you are given with known genes in the National Center for Biological Information (NCBI) website, using their Basic Logical Alignment Search Tool (BLAST) program.

Directions:
1) Go to the NCBI website, found at http://www.ncbi.nlm.nih.gov/, and click on the word “BLAST”, located on the dark blue bar near the top of the page.
2) Under the heading “Nucleotide”, click on the link for “Nucleotide-nucleotide BLAST”. One person should read the nucleotide sequence found on the index card you were given (in groups of 3) while the other person CAREFULLY types in the exact nucleotide sequence in the large empty “Search box.
3) When you or your partner finish typing, note in the space below any patterns you may have noticed about your sequence as it was being typed in.

__________________________________________________ ___________________

4) Now click on the “BLAST!” button, and after it brings you to the next screen, click on the “Format!” button and wait for your results.
5) On the webpage of your BLAST results, scroll down to the section with the horizontal colored lines, and carefully position your mouse on the “0” found below the word “Query”. Now slowly move your mouse below to the start of the first colored line. You should see the phrase “Mouse-over to show defline and scores, click to show alignments” in the white box change to indicate the name of the gene associated with the nucleotide sequence you typed in.
6) Slowly continue moving the mouse down each of the next 5 successive colored lines, taking note what appears in the white box. What seems to be the name of your human gene?

__________________________________________________ ___________________

7) Close the “results of BLAST window”, going back to the “formatting BLAST” page. Click on NCBI logo that appears in the top left hand corner of the page. This should bring you back to the NCBI home page.
8) Now scroll down till you see the word “Education”, the 3rd-to-last orange heading on the left-hand bar of the page, and click on it.
9) Scroll down till you see the word “Genomes & Genetics” (2nd-to-last orange heading), and click on “Genes and disease”.
10) Enter the name of the gene or genetic disease associated with your nucleotide sequence in the search box at the top of the page and click “Go”. Use the information returned with your search, as well as other resources on the NCBI website, to answer the questions on the other side of this page.






.................................................. .....................

SEQUENCE # 2
ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTA
TAGAAATTGACTTATTTTATTCTCATATTTACATGTGCATAATTTTCC
ATATGCCAGAAAAGTTGAATAGTATCAGATTCCAAATCT

SEQUENCE # 3
ATGTTGTGCAATATCCATCTACTGTAGTTAAGATATTCAGTAG
TTTGTTTTTCATAAGCATGTAATTGATCATATTTCTGCCAAGGATGT
GCCTTCAACTTTATAATTATAGTGTTGTAAAATATTTTTGTCTG

SEQUENCE # 4
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT
CCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
AGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCC

SEQUENCE # 5
ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCT
TTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGC
TGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCC

SEQUENCE # 6
ATGCCATCTTCCTTGATGTTGGAGGTACCTGCTCTGGCAGATTTCA
ACCGGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATC
AAGTTATAAAATCACAGAGGGTGATGGTGGGTGACCTT

SEQUENCE # 7
ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGC
CGCCGCGGAACCCCCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAG
GACCCAGAGCAGGACAGCGGCCCGGAGGAC

SEQUENCE # 8
ATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTG
CTCCTGCTGTCCATCCTCCACCCCTCTCGGCCTGGAGGGGTCCCTG
GGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTT

[مسك الختام]

الله يسعدك يارب
والله انك ساعدتيني كثير بالواجب الي قبل استفدت من الي قلتيه

وحابه هالمره انك تساعديني بالراس مول مره مو فاهمه فيه شي
انا مع استاذه حياه و د.خديجه
الاسئله هي

the name of protin is................and derived by.........(1
هذي الفقره ماعرفت اجيب الجزء الثاني منها

وباقي الاسئله كالتالي:
the number of polypeptide chains are.................(1

the number of amino acid in each chain are.................(2

select acidic
the number of amino acid in polypeptide chain A are.................(3

select *.ca and *a
the number of water molecues in the protein are.................(4

select hoh
the cofactor,inhibetor,or prosthetic group that will interact with protein are..........................(5

select ligand
type the command lines to see the disulfide bridges in display window and its number are .................................(6

E. make a gif file of your protein


هذي كل الاسئله اذا سمحتي اقرايها وشوفي اذا بعض الكومند الي كتبتها صح ولا لا

واذا قدرتي تساعديني بالباقي ياريت

[ترانيم الكفاح]

اولا الى الاخت vip لا تستحي ولا شيء ترى انا زي اختك ومو زايده عنكم بشيء بس والله هذا كله من كثر حبي لحاسوبيه فحبيت افيد غيري

اشكرك على طرح الاسئله وانا في كامل استعدادي لمساعدتكم

بسم الله

طبعا هي اكيد الاستاذه ادتكم ورقه وفيها اسئله تحلونها من موقع الncpi الي في النت وهذا مرررره حلو وسهل

الورقه فيها اسئله وفراغات واليت كانت الورقه معاي كان قدرت اكثر اساعدكم اس ما قصرت يا vip وياليت تكتبولي كل الاسئله عشان افهمكم

1- In this activity, you will be given a nucleotide sequence found in real human DNA that is associated with a genetic disease when mutated. Your task is to compare the sequence you are given with known genes in the National Center for Biological Information (NCBI) website, using their Basic Logical Alignment Search Tool (BLAST) program

طبعا هي بتفهمكم وتقول لكم انو في هذا النشاط حتشتغلوا على الDNA تبع كل طالبه ولما تبحثوا عنه في الموقع تبع ncpi بتلاقوا التسلسل الجيني خذي اول واحد واعمليله نسخ بالفاره ثم حتلاقي نهاية الصفحه كلمة PLAST حتكون في اطار ازرق اختاريها وبعدين حتنقتح لك صفحه الصقي فيها السلسه الي نسختيها بالفاره

بأسألك هي ادتكم رمز PDB لكل بنت ؟ والا انتم غير ؟؟

[مسك الختام]

انتي قصدك الpdb حق برنامج الراس مول

اذا كذا يب كل بنت لها رمز خاص فيها

[ترانيم الكفاح]

خليك معاي مسك ختام
بالنسبه للncpi الاستاذه ما ادتكم رمز او اي شيء

[RAWANDELET]

ال ncbi قالت حطو السكوينس في البلاست وشوفو ايش المرض اللي حيطلع
والمرض هو اللي نبحث عنو وعلى اساسو نحل الاسئلة

ممكن اعرف كيف اعمل save في الrasmol